|
Tuesday, November 18, 2003
Description Vectorette PCR of Yeast DNA Procedure 1) Cut 1-3 g of clean DNA overnight with 8-10U of blunt cutting enzyme in 20l Most problems come from dirty, uncut DNA. Phenol/glass bead/RNase prepared DNA works well RsaI, AluI and DraI provide good results. 2) Heat inactivate enzyme 3) Add: 3l 10x NEBuffer used in digest 1l annealed anchor bubble 1l (400U) ligase 0.5l of 5mM ATP (50M ATP final) 25.5l Water 4) Incubate at 16 C for 9-24 hours. 5) Use 5l in 100l PCR. Perkin Elmer Ampliwax is recommended for hot start. 5 l of ligation 2.5 l of 20M specific primer [M13(-47) for mTn3 library] 2.5 l of 20M 224 primer 8 l of 2.5 mM dNTPs 10 l of Taq PCR buffer 71l Water 1l Taq DNA polymerase (5U) Transfer to Perkin Elmer 9600 Thermal Cycler Denature 92C, 2 minutes 35 Cycles [92C, 20sec; 67C, 30sec; 72C, 45-180sec (>1 min/1 kb)] 72C, 90sec 6) Gel purify 80 l of PCR product in 1-3% SeaKem GTG, extract with Qiaex (Qiagen), elute with 12 l of ddWater 7) Sequence 7 l with Sequenase kit from Amersham. Use 1 l of 200-600M specific primer [M13(-47) for mTn3]. Undiluted 10 OD synthesis from Genset works well. Use high specific activity S-35 (>1000 Ci/mmol, Amersham AG1000) Boil 10' and fast cool in ice water. -------------------------------------------------------------------------------- Anchor Bubble primers 3' GAGAGGGAAGAGAGCAGGCAAGGAATGGAAGCTGTCTGTCGCAGGAGAGGAAG 5' |||||||||||| || || | | | ||| | | |||||||||||| 5' GACTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC 3' PRIMER 224 5' CGAATCGTAACCGTTCGTACGAGAATCGCT 3' To anneal bubble primers, heat a 2-4M (in ddWater) to 65 C for 5 minutes, then add MgCl2 to 1-2 mM and allow to cool to room temperature. Recipes Supplies Tips (责任编辑:泉水) |
