Thursday, November 17, 2005 Description A method for preparing competent E. coli for transformation. The key advantage is that these cells can be kept for a week at 4 degrees Celsius. Procedure 1. Grow an overnight culture of E. coli XL-1...
Tuesday, November 02, 2004 Description This is one of the standard protocols to prepare competent cells. In this the cells at a particular density are washed with CaCl2 which later helps in the transformation of plasmids into these cells....
Saturday, May 15, 2004 Description PAH AluI Polymorphism Procedure AluI; LOCATED IN EXON 7 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. PAHALU333 5' CTTGCACTGGTTTCCGCCTC 3' 100 ng/reaction Primer 2. PAHALU237 5' CCCAA...
Description DRD2 TaqI "D" Polymorphism Procedure Taq I "D" Located approximately 3.5 kb downstream from exon 2 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1: TaqDck4 '5 CCT CTG AGG CTT ACT GTC TG 3' 100ng/Reaction Prime...
Saturday, May 15, 2004 Description SLC6A3 3' VNTR Polymorphism Procedure 40-bp VNTR located in 3'-UTR (422 bp downstream from G2319A MspI polymorphism) Template: Genomic DNA 100-200 ng/reaction volume of 20 L Primer 1. DATVNTRF 5'-TGTGGTGT...
Saturday, May 15, 2004 Description PAH PvuII A Polymorphism Procedure PvuII A; LOCATED NEAR THE 5' END OF INTRON 2 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. PAHPVU2-1 5 -GGC ATG ACT GGA TAC GAT TAG-3' 100 ng/reacti...
Description NGFR HincII Polymorphism Procedure HincII (PCR location in AC006487: 11430-12116 bp; HincII location in AC006487: 11499-11504bp 1695 bp downstream from Exon1 of NGFR) Template: Genomic DNA 100-200 ng/reaction volume of 25 l. Pr...
Saturday, May 15, 2004 Description PAH PvuII B Polymorphism Procedure PvuII B LOCATED IN INTRON 3 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. PAHPVUb-1 5' GCCTGAAAGCAATACAGAGG 3' 100 ng/reaction Primer 2. PAHPVUb-2 5...
Saturday, May 15, 2004 Description NGFR HindIII Polymorphism Procedure HindIII (PCR location in AC006487: 804-1295 bp; HindIII location in AC006487: 969-974 bp) Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. NGFRHND3F 5...
Saturday, May 15, 2004 Description DRD2 HincII Polymorphism Procedure Hinc II polymorphism in DRD2 located 1.9 kb downstream from exon 8 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. D2EX8F9: 5' -GAG CAA TCT TGT GCT CC...