Description DRD2 TaqI "D" Polymorphism Procedure Taq I "D" Located approximately 3.5 kb downstream from exon 2 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1: TaqDck4 '5 CCT CTG AGG CTT ACT GTC TG 3' 100ng/Reaction Prime...
Saturday, May 15, 2004 Description SLC6A3 3' VNTR Polymorphism Procedure 40-bp VNTR located in 3'-UTR (422 bp downstream from G2319A MspI polymorphism) Template: Genomic DNA 100-200 ng/reaction volume of 20 L Primer 1. DATVNTRF 5'-TGTGGTGT...
Saturday, May 15, 2004 Description PAH PvuII A Polymorphism Procedure PvuII A; LOCATED NEAR THE 5' END OF INTRON 2 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. PAHPVU2-1 5 -GGC ATG ACT GGA TAC GAT TAG-3' 100 ng/reacti...
Description NGFR HincII Polymorphism Procedure HincII (PCR location in AC006487: 11430-12116 bp; HincII location in AC006487: 11499-11504bp 1695 bp downstream from Exon1 of NGFR) Template: Genomic DNA 100-200 ng/reaction volume of 25 l. Pr...
Saturday, May 15, 2004 Description PAH PvuII B Polymorphism Procedure PvuII B LOCATED IN INTRON 3 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. PAHPVUb-1 5' GCCTGAAAGCAATACAGAGG 3' 100 ng/reaction Primer 2. PAHPVUb-2 5...
Saturday, May 15, 2004 Description NGFR HindIII Polymorphism Procedure HindIII (PCR location in AC006487: 804-1295 bp; HindIII location in AC006487: 969-974 bp) Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. NGFRHND3F 5...
Saturday, May 15, 2004 Description DRD2 HincII Polymorphism Procedure Hinc II polymorphism in DRD2 located 1.9 kb downstream from exon 8 Template: Genomic DNA 100-200 ng/reaction volume of 25 l Primer 1. D2EX8F9: 5' -GAG CAA TCT TGT GCT CC...
Saturday, May 15, 2004 Description APOB EcoRI Polymorphism Procedure EcoR I Template: Genomic DNA 100-200 ng/reaction volume of 25 l. Primer 1. APOBEC1 5'-CTG GCT TGC TAA CCT CTC TG-3' 100 ng/Reaction Primer 2. APOBEC2 5'-GAG AAG CTT CCT G...
Thursday, December 04, 2003 Description Construction of a genomic DNA library Procedure Library construction Two micrograms of genetically modified genomic tobacco plant DNA was digested with 60 units of the restriction enzyme, BamHI and l...
Description Agrobacterium Transformation Procedure 1. Seed culture in YEP/Streptomycin+ media, 28, shaking for overnight 2. Add 3-4 mL of overnight cultured cell to 50 mL of fresh YEP/Streptomycin+ media, 4 hr shaking (OD6000.5) 3. 4000 rp...